Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ_SDHA | |||
Gene | SDHA | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Primary Great Saphenous Vein Varicosities | ICD-10 | Varicose veins of lower extremities without ulcer or inflammation (I83.9) |
DBLink | Link to database | PMID | 29577902 |
Experimental Method | |||
Sample Type | Primary great saphenous vein varicosities vein samples with control group paired | Comparison | 11 in the Primary Great Saphenous Vein Varicosities (PGSVV) group and 11 in the control group |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward AAGAAGCCCTTTGAGGAGCAC ReverseGCAGAAGCGTATGAAGACAGTTATG | Statistics | Fold Change : Downregulated (2.5 fold) pvalue : p<0.05 |
Citation | |||
Zhang, W, Li, L, Si, Y, Shi, Z, Zhu, T, Zhuang, S, Fu, W (2018). Identification of aberrant circular RNA expression and its potential clinical value in primary great saphenous vein varicosities. Biochem. Biophys. Res. Commun., 499, 2:328-337. |